General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Sigma-Aldrich Co. LLC
description: Powered by Eupheria Biotech. Quality Level: 100. product line: MISSION®. . form: lyophilized powder. esiRNA cDNA target sequence: TTCATTCGCAATCAGGTTTTTACTACAAAACCAGAATACCAAAGTTTGGGAGAGATTTCTCTTACCACTATCCATCCTGTGACTTGTACTTTGTTGGTGCAAGTTCTGAAGTTTATAGGTTAAACTTAGAACAAGGACGATACCTGAATCCTCTACAAACTGATGCTGCGGAGAATAATGTTTGTGACATAAATTCAGTGCATGGCTTGTTTGCCACAGGAACCATAGAGGGTAGAGTGGAGTGCTGGGACCCAAGAACTCGAAACAGAGTTGGCCTGTTAGACTGCGCCTTAAACAGTGTC. Ensembl | human accession no.: ENSG00000115761. NCBI accession no.: NM_024894. shipped in: ambient. storage temp.: −. 20°C. Gene Information: human ... NOL10(79954), NOL10(79954). Storage Class Code: 10 - Combustible liquids. Flash Point(F): Not applicable. Flash Point(C): Not applicable.- UPC:
- 42202202
- Condition:
- New
- HazmatClass:
- No
- MPN:
- EHU159001-50UG
- Temperature Control Device:
- Yes
akash.verma@cenmed.com
(732) 447-1115





