General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
GenBank is a registered trademark of United States Department of Health and Human Services
MISSION is a registered trademark of Sigma-Aldrich Co. LLC
product line: MISSION®. . form: lyophilized powder. esiRNA cDNA target sequence: GAAGCTATTGGAAGAGATGCTCAAAGAAGAAAAAATTACCATAATCCAATAAAGAAGAAGACCTGAGATCCAGGAAGCAGATGATCTGAACTGCAGAGAAAGTTCAGGAAAGTTCCCTCATTCATGATGATGGGAAATAACAGTAAATTCTGTACAGCAGTCTTGGACAACAACCAATCTAAACTGGCACAGTGCAGAGGCAATCAACAGAGAACATAATATTGATAGAATGCCTGACGCTTTTGAT. GenBank®. accession no.: AA961184. NCBI accession no.: XR_108545.1, XR_112631.1. shipped in: ambient. storage temp.: −. 20°C. Gene Information: human ... LOC100506827(100506827). Storage Class Code: 10 - Combustible liquids. Flash Point(F): Not applicable. Flash Point(C): Not applicable.- UPC:
- 42202202
- Condition:
- New
- HazmatClass:
- No
- MPN:
- EHNC006231-20UG
- Temperature Control Device:
- Yes
akash.verma@cenmed.com
(732) 447-1115





